Journal: Cell

Article Title: A membrane-less organelle associated with the endoplasmic reticulum enables 3′UTR-mediated protein-protein interactions

doi: 10.1016/j.cell.2018.10.007

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: pLKO.1-shRNA2 Control (scramble) , Sarbassov et al., 2005 , Addgene, Cat# 1864.

Techniques: Recombinant, Blocking Assay, Protease Inhibitor, Reverse Transcription, Mutagenesis, Plasmid Preparation, Control, Luciferase, shRNA, Software

Journal:

Article Title: Slug Inhibits Proliferation of Human Prostate Cancer Cells via Downregulation of Cyclin D1 Expression

doi: 10.1002/pros.21213

Figure Lengend Snippet: A: Western blot analysis of Slug expression in PC-3 cell lines harboring control shRNA or Slug shRNAs. PC-3 cells were infected with lentiviruses expressing control shRNA, Slug shRNA1, or Slug shRNA2, and selected with puromycin (1 µg/ ml). Proteins were extracted from the stable lines and analyzed by Western blot with anti-Slug antibody and anti-β-actin antibody.

Article Snippet: The pMIGw-cyclin D1-HA and the pMIGw-Cylin D1-HA T286A were constructed by subcloning a 1,151-bp XhoI-BamHI fragment from pcDNA cyclin D1 HA and pcDNA cyclin D1 HA T286A ( 32 ) respectively, into pMIGw vector. pLKO.1-Slug shRNA1 (target sequence- 5’ CAGCTGTAAATACTGTGACAA3’) and pLKO.1-Slug shRNA2 (target sequence- 5’ GCCAAATCATTTCAACTGAAA’) were obtained as a set (RHS4533-MN_003068) from Open Biosystem (Huntsville, AL). pLKO.1-Slug shRNA3 (target sequence- 5’CAGACCCAT TCTGAT GTAAAG, Addgene plasmid #10905) ( 33 ) or pLKO.1-control shRNA (containing non-target scramble shRNA, Addgene plasmid #1864) ( 34 ) were purchased from Addgene (Cambridge, MA).

Techniques: Western Blot, Expressing, Control, shRNA, Infection